Welcome to the wonderful world of Biology !!!
Our textbook is entitled Prentice Hall Biology. Your student will receive a copy to keep at home and I have a 'class set' for use in the classroom.
Assignments will be posted weekly; however, make sure you check back often, as unexpected occurrences may necessitate changes.
This webpage is intended to HELP the absent student stay on track. It is in no way all-inclusive or a substitution for what occurs in the classroom.
I am available 8:00 - 8:30am Monday -Friday for tutoring (unless an unforseen emergency arises).
Be sure to find the correct date in question; you may need to scroll down a little to find it.
*******************************************************
Fall Semester Spring Semester
Nature of Science / Safety Genetics
Chemistry / Biomolecules Biological Change
Cellular Basis of Life Populations / Evolution
Energy in Living Systems Living Systems
***********************************************************
January 7 - 11
Welcome back / Happy New Year
Did you read chapters 12 & 13 over the holidays ?
M Student holiday
T DNA discovery
W Notes: Nucleic acids/replication (see below)
Th DNA song
DNA project due 1/23
Vocabulary due 1/11
F Review DNA song
DNA /RNA practice due 1/14
Open note Quiz - 1/18
Nucleic Acids pp notes for web
Nucleic Acids are the chemical link between generations dating back to the beginning of life on earth. A nucleic acid is a complex macromolecule that stores information in cells in the form of a code. Nucleic acids are made of long chains of nucleotides. Nucleotides are made of three components: sugar, phosphate group, nitrogen base
Examples of nucleic acids include DNA and RNA. DNA = Deoxyribonucleic Acid
It’s components are : deoxyribose sugar, phosphate group, nitrogen base. James Watson and Francis Crick proposed that DNA has a specific pairing between nitrogen bases:
Adenine (A) pairs with Thymine (T) and Guanine (G) pairs with Cytosine (C)
Watson and Crick also said the paired nitrogen bases formed two long strands of nucleotides that compliment each other (complimentary base pairing rule). Nitrogen bases are connected between sugars and phosphates. They declared “ this structure is a double helix”. DNA forms chromosomes, units of genetic information which pass from parent to offspring. If you unraveled all your chromosomes from all of your cells and laid out the DNA end to end, the strands would stretch from the Earth to the Moon about 6000 times.
RNA has a different sugar than DNA. RNA = ribonucleic acid. It’s components are: ribose (sugar), phosphate group, nitrogen base. It also has different bases than DNA. Adenine pairs with Uracil (There is no Thymine in RNA). Cytosine still pairs with Guanine.
Review: DNA RNA
Double stranded Single stranded
Sugar – deoxyribose Sugar – ribose
Adenine – Thymine Adenine – Uracil
DNA Replication
Why must DNA replicate ? Every time a cell divides, it must first make a copy of it’s chromosomes (during Interphase). Therefore, each cell can have a complete set of chromosomes. Without replication, species could not survive and individuals could not successfully grow and reproduce.
How DNA replicates: DNA is a molecule composed of two strands, each consisting of a sequence of nucleotides. The order of the nitrogen bases on one strand mandates the sequence of bases on the complementary strand. If you know the bases on one strand you can predict which bases will occur on the complementary strand.
A-T, G-C, etc.
During replication each strand serves as a template to create a new strand.
Steps in Replication: enzymes break down the hydrogen bonds between the two DNA strands unzipping the molecule. As the DNA unzips, free nucleotides (from surroundings in the nucleus) bond to the single strands by base pairing. Another enzyme bonds the new nucleotides into a chain. The result of this process is the formation of two DNA molecules, each identical to the original molecule.
Reflect and Review:
1. What are the two types of nucleic acids?
2. What are the three components of a nucleotide?
3. Compare DNA with RNA.
4. List the steps in DNA replication
5. Make up your own questions from the notes.
***********************************************************
January 14 - 18
M H.W. due
Notes RNA, Proteins, Protein Synthesis (see below)
H.W. due 1/15
T Color and practice Protein Synthesis
W Protein Synthesis animation
H.W. Crossword due 1/17
Th Practice on board
Protein Synthesis review due 1/18
Don't forget Quiz tomorrow
F Open note Quiz - DNA, RNA, Protein synthesis
Review sheet for Test 1/24
DON'T FORGET - DNA project is due 1/23
Notes Protein Synthesis
Structure and function of RNA
Why is RNA needed ? Proteins are made by ribosomes outside the nucleus (on the rough endoplasmic reticulum). DNA cannot leave the nucleus ( it’s too big). RNA is needed so that it can carry the genetic code (DNA) needed for making proteins to the ribosomes.
What is RNA? RNA = Ribonucleic Acid. The sugar in RNA is ribose. In RNA the base thymine is replaced with uracil. There are 3 kinds of RNA. rRNA = ribosomal RNA which makes up ribosomes. mRNA = messenger RNA which carries the genetic code out of the nucleus to the ribosomes. tRNA = transfer RNA which transfers amino acids to the ribosome in order to make proteins.Proteins are mino acids that are joined together by peptide bonds.
Uses of Proteins – Structural – tissue building (cells, organelles, cytoplasm)., Hormones – chemical messages(regulation of specific activities in the body like growth hormone), Pigment – color (chlorophyll in plants, melanin in skin, hemoglobin in blood), Enzymes – intracellular – inside cell, extracellular – outside cell
Properties of enzymes – protein molecule, catalyst (affects the rate of a chemical reaction without being used up), affected by pH an temperature, selective – enzymes only work on specific chemical reactions, enzymes end in “ase” and include the name of the substance on which they act: ex lactose = lactase
Coenzymes = substances that work with an enzyme by increasing its effectiveness. Examples include viatamins and minerals.
mRNA carries the code for an amino acid in a series of 3 nucleotides (like DNA triplet) A group of 3 mRNA nucleotides is called a codon. A group of 3 tRNA nucleotides is called an anti-codon (opposite of codon).
Remember your complimentary base pairing rules: If mRNA is UAG then tRNA is AUC.
The genetic code is universal – codons code for the same amino acids in all known life forms.
Protein Synthesis is a two part process: Transcription in the nucleus and Translation in the cytoplasm. Transcription = mRNA copies the code from DNA. First DNA unzips; RNA nucleotides bond to the exposed bases on the DNA strand; Transcription continues until a stop “codon” is reached. Translation = mRNA is used to make protein. First mRNA leaves the DNA in the nucleus and travels to a ribosome. Next the ribosome begins “translating” the mRNA into protein when it reaches a “start” codon. The ribosome “translates” the mRNA into a sequence of amino acids that make up a specific protein. Translation continues until a “stop” codon is reached. tRNA carries an amino acid on one end. The other end contains the anti-codon (three nitrogen bases) that will match up with the mRNA codon. tRNA molecules match their anti-codon to the mRNA codon. a protein is formed as tRNA’s release their amino acids which are bonded together to make a protein by rRNA (peptide bond).
All of the proteins in your body are made up of combinations of only 20 different amino acids linked together in different ways.
***********************************************************
Jan 21 - 25
M Student/Staff Holiday
T More Protein synthesis practice
W DNA Project due
Review for Test
Th More Protein Synthesis practice
in computer lab
F Test - DNA, RNA, Protein Synthesis
Chapter 11 Vocab due 1/28
Vocabulary Chapter 11
Define each of the following to be able to understand them in the context of a sentence.
Gregor Mendel, fertilization, true-breeding, hybrid, allele, segregation, homozygous, heterozygous, phenotype, genotype
***********************************************************
Jan 28 - Feb 1
Begin new unit - Genetics
M Notes - Genetics (see below)
T Benchmark Test for Biology
W Finish notes
Th The Story of Gregor Mendel
F Video - The Power of Genes
Notes - Genetics
DNA - hereditary information found in nucleus
directs activity in cell
Chromosome - DNA and chromatin tightly coiled
together
Gene - a portion of DNA that codes for a specific trait
Ex. seed color = pair of alleles -1 from Mom & 1 from Dad
Allele - alternate form of a gene that controls the
expression of the gene ( often one can be
dominant and the other recessive )
Genetic traits :
1. Dominant - ( use capital letters )
An allele that prevents the expression of a
recessive allele
2. Recessive - ( use lower case letters )
An allele that is hidden by a dominant allele
Example - T = Tall ( dominant )
t = short ( recessive )
soooo....... Tt = Tall
TT = Tall
tt = short ( recessive alleles must be in a pair to show)
Try it....
If Y = Yellow and y = green then
YY = _________
Yy = _________
yy = _________
Homozygous - two identical alleles for the same trait
(same) ex. YY or yy
Heterozygous - two different alleles for a trait
(different) ex. Yy
Genotype - genetic combination of alleles
ex. Yy, YY, Bb, bb
Phenotype - the appearance or way an organisms
genes are expressed
ex. Yellow, Yellow, Brown Blue
Test cross - a way to determine purelines
TT = tall = homozygous pureline
Tt = tall = heterozygous ( hybrid )
tt = short = homozygous pureline
***********************************************************
Notes - Genetics continued
Incomplete Dominance - heterozygous alleles
expressed by blending ( neither is dominant)
Ex: Red carnation x White carnation = Pink carnation
Codominance - heterozygous alleles both expressed
together ( NOT blended )
Ex: Brown cow x White cow = Brown & White (roan)
Polygenic inheritance - traits determined by more
than one gene
Ex: eye color ( melanin = pigment )
a little melanin = blue
a little more = green
a little more = brown
Sex-linked traits
Humans have 23 pairs of chromosomes. One pair is related to the sex of an individual, these chromosomes are called sex chromosomes. The other 22 pairs of chromosomes are called autosomes.
Sex Chromosomes
In humans, the sex of an individual depends on the presence or absence of the Y chromosome. A normal human female is XX. A normal male is Xy
Who determines the sex of the child ? The male.
Genes that are located on the X chromosome are called sex-linked genes. Traits determined by sex-linked genes are called sex-linked traits.
Ex. colorblindness, hemophilia, baldness
Sex linked traits are recessive. This means both x chromosomes in a female must have the gene in order for the trait to be expressed.
If only one x chromosome is present ( in males) and has the sex linked gene, then the trait will be expressed.
A carrier is a person that has the trait on only one x chromosome and does not express the trait. Carriers of sex linked traits are always women.
Hemophilia is characterized by uncontrolled bleeding. It is a sexlinked disorder caused by errors in DNA that codes for the proteins involved in clotting.
Another type of sex linked trait is male pattern baldness.
Try the following crosses and give the genotype and phenotype for each:
Colorblind male X normal female
Normal male X carrier female
Normal male X colorblind female
Bald male X normal female
Six Basic Crosses
AA x AA All AA
AA x aa All Aa
aa x aa All aa
Aa x AA 2Aa : 2 AA
Aa x aa 2Aa : 2aa
Aa x Aa 1AA : 2Aa : 1aa
Blood Types
Blood type is an example of a multiple allele ( a gene
with more than two alleles)
Three alleles exist for Blood Types - A, B, O
A and B are dominant over O
A and B together are codominant ( both expressed )
Genotypes Phenotypes
AA A
BB B
OO O
AO A
BO B
AB AB
AB = Universal recipient
O = Universal donor
Rh factor = Rh+ surface marker on RBC
Rh- No marker
If Rh- mom and Rh+ fetus, mom must be given a
drug to prevent antibodies from forming
against Rh+ fetus
Practice: Mom = OO x Dad = AB
Notes: Chromosomal & Gene Mutations pp for web
Proteins and Mutations:
Some proteins carry out functions within the cells of an organism. Other proteins are exported out of the cell for other purposes. Still other proteins are used as activators or repressors, turning genes on or off. Therefore, a change in a cell’s proteins could have dramatic effects on the cell’s structure or function. Changes in the DNA can change the proteins made by the cell. A random change in the sequence of nucleotides in DNA is called a mutation. Some mutations have little or no effect on the organism, others are harmful and very few are beneficial. There are two types of mutations: Chromosomal and Gene. Chromosomal mutations are changes in the structure of a chromosome. Gene mutations are errors that occur within individual genes in a chromosome. Gene mutations can involve a single nucleotide or they can affect sections of DNA that include many nucleotides. The deletion or addition of nucleotides that disrupts codons is called a frameshift mutation. Because mRNA is read in codons (three-base sections) during translation, an addition or deletion of nucleotides can alter the sequence of bases, or reading frame, of the genetic message. Because each mRNA codon corresponds to an amino acid, altering the codons may alter the amino acid sequence. The end result may be an entirely different protein product. Frameshift mutations can have an enormous impact on an organism’s structure and function. A change in only one nucleotide is a point mutation. Because a point mutation affects a single codon, it tends to be far less disruptive than a frameshift mutation. Some amino acids are coded for by more than one codon, and substitution may simply change one codon to another codon for the same amino acid. About 30% of all substitution mutations produce no changes in proteins. In the remaining 70% of point mutations, changed nucleotides cause a different amino acid to be incorporated into a protein. The resulting protein may function normally or may be defective. A third and very common point mutation occurs when a codon in the middle of a gene is changed to a stop codon. For example UGC = Cysteine but UGA = Stop. When genes with this mutation go through protein synthesis, translation is halted before the amino acid chain is completed.
*********************************************************
Feb 4 - 8
M
T
W
Th
F
Review Sheet - Genetics (see below)
1. A ________ is a segment of DNA that helps control a particular hereditary trait. A __________ is made up of genes.
2. An organism's outward (physical) appearance is its ______________.
An organism's genetic makeup is known as the ______________.
3. When both alleles on a chromosome have the same expression, the organism is ___________ for a trait. If the alleles for a trait are different, the term _____________ is used. For example, Bb is ____________ while BB or bb is _____________. The capital letter is always used to represent a _____________ allele whereas, a lower case letter is used for ____________ alleles.
4. In __________ dominance, the traits appear to blend but, in ______________ both alleles are dominant and both are expressed in the organism.
5. A ____________ is an organism that does not show symptoms of a disorder or trait, but has the recessive allele that may be inherited by its offspring.
6. Define the term Polygenic trait :
7. List some examples of traits that are polygenic.
8. Humans have _____ pairs of chromosomes. _____ pair of sex chromosomes and ____ pairs of autosomes.
9. The genotype of females is ________ and the genotype of males is ______. Therefore, everyone inherits a ______ chromosome but males only have _____ of them.
Who determines the sex of a child ?
List some examples of sex-linked traits.
Who is more at risk of inheriting a sex-linked disorder ? ( male or female)
10. Define the term multiple allele.
11. How many alleles for blood type are present in the population ?
Name them.
12. Allele ____ and ____ are always dominant over O. Yet ___ and ___ do not dominate over each other, instead they can be expressed together ( this is a good example of ____________).
13. The four possible blood types that can be inherited are ___, ___, ___, and ___.
14. Blood type ____ is considered a universal recipient whereas blood type ____ is a universal donor.
15. A person with Rh+ blood has a surface protein on the membrane of their _____ blood cells. A person with ______ blood does not have the marker. The only time Rh is a problem is when the mother is ____ and the fetus is ____. The mother then must be given a drug to prevent her from forming _____________ against the fetus.
16. What is a mutation ?
17. What is a mutagen ?
18. Which is generally worse, a gene mutation or a chromosomal mutation?
19. Briefly describe the following types of mutations.
a. point
b. frameshift
c. inversion
d. translocation
e. deletion
f. nondisjunction
g. monosomy
h. trisomy
i. polyploidy
20. What are the symptoms of Huntington's disease ?
Is there a test for it ?
Is there a cure for it ?
What part of the body is affected ?
21. What is a pedigree ?
*Go back over your worksheets and practice : Punnett squares, Sex-Linked Traits, and Pedigrees ( here are a few, but you have more, for practice)
In fruit flies, a dark body (D) is dominant and a light body (d) is recessive.
One parent is homozygous recessive and the other is heterozygous ( hybrid)
22. What is the genotype of the homozygous recessive parent?
What is the genotype of the heterozygous ( hybrid) parent?
23. What percentage of the offspring are dark colored ?
What percentage of the offspring are light colored ?
24. Describe the offspring of a cross between a normally pigmented squirrel and an albino squirrel. Show both cases ( NN x nn and Nn x nn)
**********************************************************
Feb 11 - 15
M In class activity: build a pedigree
Assign Genetic Disorder Project (see below)
T Jeopardy: review for genetics exam
W Genetics Exam
*6 weeks exam next Tuesday (2/19)
Review: look over class notes and review sheets for DNA and Genetics
Th In class activity: Gene Man
F Computer Lab: Karyotyping activity (see below)
* Genetic Disorder Project:
Each student is to make a trifold pamphlet about an assigned genetic disorder. The pamphlet should be titled with the name of the disorder as well as state and answer specific questions.
* Karyotyping Activity
http://www.biology.arizona.edu/human_bio/activities/karyotyping/karyotyping.html
Introduction
This exercise is a simulation of human karyotyping using digital images of chromosomes from actual human genetic studies. You will be arranging chromosomes into a completed karyotype, and interpreting your findings just as if you were working in a genetic analysis program at a hospital or clinic. Karyotype analyses are performed over 400,000 times per year in the U.S. and Canada. Imagine that you were performing these analyses for real people, and that your conclusions would drastically affect their lives.
G Banding
During mitosis, the 23 pairs of human chromosomes condense and are visible with a light microscope. A karyotype analysis usually involves blocking cells in mitosis and staining the condensed chromosomes with Giemsa dye. The dye stains regions of chromosomes that are rich in the base pairs Adenine (A) and Thymine (T) producing a dark band. A common misconception is that bands represent single genes, but in fact the thinnest bands contain over a million base pairs and potentially hundreds of genes. For example, the size of one small band is about equal to the entire genetic information for one bacterium.
The analysis involves comparing chromosomes for their length, the placement of centromeres (areas where the two chromatids are joined), and the location and sizes of G-bands. You will electronically complete the karyotype for three individuals and look for abnormalities that could explain the phenotype.
Your assignment
Karyotyping is one of many techniques that allow us to look for several thousand possible genetic diseases in humans.
You will evaluate 3 patients' case histories, complete their karyotypes, and diagnose any missing or extra chromosomes.
Patient A
Match the chromatids with their homolog by clicking on the number below it; those highlighted blue.
Once you have successfully matched all the chromatids to their homologues match the extra chromosome. Having an extra chromosome is known as trisomy.
Iterpret the Karyotype
A 1. What notation would you use to characterize Patient A's karyotype?
Using the chart under making a diagnosis…
A 2. What diagnosis would you give patient A?
Patient B
Match the chromatids with their homolog by clicking on the number below it; those highlighted blue.
Once you have successfully matched all the chromatids to their homologues match the extra chromosome.
Interpret the Karyotype
B1. What notation would you use to characterize Patient B's karyotype?
Using the chart under making a diagnosis…
B 2. What diagnosis would you give patient B?
**********************************************************
Feb 18- 22
M Review for 4th 6-weeks exam (see below)
T 4th 6-weeks exam
W Course Fair
Th Biotech Notes (see below)
F Library day: Genetic Disorder Project
4th Six weeks Review-
Turn in on day of test for up to 5 points extra credit.
Draw a line matching the phase to the correct word
o Heritable genetic material that contains the sugar Deoxyribose
o Heritable genetic material that contains the sugar Ribose
o Linear chains or amino acids whose sequence is defined by a gene
o The area of eukaryotic cells in which transcription occurs
o The final product of translation
RNA
Nucleus
Protein
DNA
Protein
The nucleotide __________________ complements adenine in RNA
The nucleotide ___________________complements adenine in DNA
TACAAATTTTTCCCCGGGGCCGGCCTTATT
Transcribe
AUGUUUAAAAAGGGGCCCCGGCCGGAAUAA This sequence is known as _____________________
Translate
UAC/AAA/UUU/UUC/CCC/GGG/GCC/GGC/CUU/AUU
Where in the cell do you find this sequence?Tyr- Lys- Phe- Phe-
Draw in tRNA, show how the amino acids are brought together. (Use the codon chartin your book)
What is the product of transcription called?
From start (AUG) to stop (UAA) what is this sequence of DNA generally known as?
How are genes related to proteins?
What is the function of mRNA, rRNA, and tRNA?
Describe or draw and label the structure of DNA. Use these words: Phosphate,
Deoxyribose Sugar, Nucleic Acid, Double Helix
Describe the structure of mRNA. single stranded or double stranded
Where is mRNA made, where does it go, and what other types of RNA does it interact with?
What is translation and where does it occur in the cell?
How many bases are in a codon? How many codons per amino acid?
Word Bank
Alleles Chromosome Genes Mutations Phenotype Genotype Co-dominance Incomplete dominance Rr rr RR heterozygous Complete Dominance homozygous polygenic inheritance multiple alleles
A_______________ is made up thousands of genes which are composed of pairs of ___________________, one from each parent. _______________ control particular hereditary traits. Many traits can be physically seen as a persons ______________ . Test crosses can be used to determine if an organism is _____________ or ___________ for a trait. If we know enough about an organism we can determine it’s genotype from its phenotype. For example, if we know that red is dominant over white in snapdragons a pink flower would tell us that the plant is ____ or _____________ and that it exhibits _____________ (type of dominance) for flower color. Similarly, if we were to find red and white spotted Tiger Lilies we would know that the plant exhibits _______________ (type of dominance) for flower color. Things get a little more interesting when we start talking about traits that are controlled by _________________________, like blood type, because it they can exhibit different types of dominance. The types of dominance seen in blood type are ____________________ for A and B and _______________________ for A and B over O
- List genotypes for these monohybrid crosses.
Genotype
AA x AA
AA x Aa
AA x aa
Aa x Aa
Aa x aa
aa x aa
What is the genetic cause for Down syndrome/ what type of mutation does it result from: chromosomal or gene trisomy or monosomy.
What different things can a karyotype show?
Frameshift mutations are caused by:
What is translocation?
Non-disjunction results in:
How can you pass on a mutation to your offspring?
How many chromosomes are found in a human diploid cell? A haploid cell (gamete)?
What is a sex-linked trait?
Q30 from Genetics Exam
A normal male and female had a son who became bald at 23 years of age. What is the genotype of the mother?
Make a sex-linked Punnett square: XDXd , XDY
Who’s my baby’s daddy? Mother: type O
Baby: type B Father? Brian: AB
Baby: type AB Father? Blake: O
Baby: type O Father? Brandon: B
A= pointy head, a= flat head B=big feet, b= small feet
Use foil to show the possible combinations of alleles AABb & AaBb could produce in a gamete.
Build a dihybrid punnett square to cross these individuals
**Biotech Notes
Changing the Living World
Spaniards introduced horses to North America in the early 1500s. Over a span of 200 years the Palouse and Nez Perce acquired horses of mixed color and temperament to create the spotted and gentle Appaloosa- the 1st recognized breed of North America.
In the practice of ______________________ humans_____________________________________________
Hybridization: _________________________________________________
____________________________________________________
For example hybridization could be used to combine disease resistance in one plant with the food producing capacity of another.
Once a breeder has produced a population of organisms with the desired traits (ie. large & resistant fruit) they would use ____________________ - ________________________________________ to keep the line pure or true… to keep all offspring the same.
Concept Check:
Breeding only dogs that are good at catching rats is an example of
____________________________________
Breeding a Labrador with a Labrador (not related) is an example of
____________________________________
Breeding a Labrador with a Poodle is an example of
____________________________________
What is a mutation?________________________________________
How might a mutation occur?_________________________________
Manipulating DNA
Until recently animal and plant breeders were limited to __________________________
When breeders and scientists tried to add variation through the use of _____________ the changes were _________________ & _____________________
Today scientists use their knowledge of the ____________________________________
and its chemical properties to _______________________________________________.
This is known as _________________________________________.
DNA is extracted from a cell using a variety of chemical procedures.
Once the DNA has been extracted it is much too large to be analyzed. Biologists cut DNA into smaller fragments with ________________- ________________
There are hundreds of known restriction enzymes that all cut DNA in unique patterns.
A few examples are EcoR1 and Hae3
EcoR1: _____ & _________________ Hae3__________& ____________
TACTTAAGCACTCCTAGGACCATCCGGACC TACTTAA GCACTCCTAGGACCATCC GGACC
ATGAATTCGTGAGGATCCTGGTAGGCCTGG ATG AATTCGTGAGGATCCTGGTAGG CCTGG
Now that the DNA has been cut into smaller, more manageable pieces we have to organize it.
Gel Electrophoresis- __________________________________________________________
DNA fragments are placed at one end then the gel is placed in an______________.
Basically that means that one end has a ___________ charge and the other end has a ___________ charge.
Because DNA fragments carry a _______________ charge they move toward the ______________ end of the field/ gel.
Fragments separate because ______________ fragments slip through the gel faster than __________________ fragments.
See Fig. 13-6
Gel Electrophoresis can also be used to read a sequence of DNA.
Researchers have developed a cleaver technique to read DNA by determining the order of bases.
Many copies of a single strand of __________ are combined with __________________________ and the four nucleotide bases A, T, G and C in a test tube.
The trick: a small number of each base are added that are ___________________________ and that ______________________________.
As DNA polymerase goes to work it uses the single strand as a template to make one new DNA strand after another. Each time a ___________________ base is added to a new DNA strand the synthesis of that strand is _____________________.
When DNA synthesis is completed the new DNA strands are different lengths.
See fig. 13- 7
***********************************************************************
February 25-29
M Student Holiday
T Finish in class biotech activity from Thursday
W In class activity: Who ate the cheese?
Th Genetic Disorder Projects Due/ Presentations
F In class activity: Voyage of the Beagle
HW: 16- 1 questions 1-4 (at the end of the section)
**************************************************************************
March 3rd- 7th
M In class notes sect. 16.1 and 15.1 (see below)
T Computer Lab: sect. 15.2
W TAKS
Th Section 15.3
F Galapagos Video
*Evolution & Population Genetics
Section 16.1 Population Genetics
A __________________ is a group of similar and _______________________________ that can mate and ________________________________________________________.
A _________________________ consists of ___________________________________________ ________________________________________________________________________________
________________________________- study of _______________________________________
________________________________________________________________________________
Concept Check:
Is the Appaloosa of the Nez Perez the same species as the horses brought by the Spanish? ____________________
Is the population of snapping turtles in the turtle pond at UT the same as the population of snapping turtles found in the lake?___________________________
Variation and Gene Pools
The different forms of a gene are known as _________________.
_________ __________- total number of all the __________ for all the genes in a ______________
_____________________, or relative frequency of an allele, is the __________________________
________________________________________________________... in a population.
A Population of Rabbits:
1 Brown BB Mate the P generation
3 White bb Mate the F1 generat
How do the allele frequencies change?
The point is… that as a population interbreeds, __________________________________________
Evolution: _______________________________________________________________________
________________________________________________________________________________
Concept Check
William studies a population of flies for his genetics lab and determines that the allele frequency of red eyed flies to white eyed flies 2:3. Which eye color is dominant?
After turning in his work he reads a paper published by other, more educated scientists saying that they found the allele frequency of red to white eyed flies to be 3:2.
Should William ask for more time to work with his flies
Sources of Genetic Variation
_________________ - changes in _________________________________
_____________________________________
______ _______________ - causes most heritable differences.
Because each chromosome of a pair moves independently during meiosis 8.4 million different combinations can be produced… per person!
Random mating works against evolutionary change genetic variation by guaranteeing that the genes of a population are thoroughly mixed among the members of the next generation.
Migration - ______________________________________________________________________
______________________________ - some genotypes are more likely to survive in a particular environment
Ex. White rabbit v. brown rabbits in a snow covered environment.
______________________________ - Some individuals are more likely to mate and pass on their genes than others.
Ex. Humans, Sea Lions
Small population- change in________________________________________________________
Ex. A small population could easily have all girls or all boys in a generation… trouble!
Single Gene & Polygenic Traits
The number of phenotypes produced for a given trait depends on how many genes control the trait.
Single- gene trait: controlled by ____ gene that has ____ alleles.
Polygenic traits: Each trait is controlled by _________ genes and each gene often has _______ alleles
Section 15. 1 Voyage of the Beagle
During his travels Darwin
_________________________________________ _____________________________
+ = _____________________________
_________________________________________ _____________________________
_____________________________
Darwin’s Observations
Darwin was intrigued by the fact that so many plants and animals seemed remarkably ___________________________ to whatever environment they inhabited.
Darwin was puzzled by where different species lived and did not live. He exected to see_____________________________________________________________________.
Why were there no rabbits in the grasslands of Australia?
Why were there no kangaroos in the grasslands of Argentina or England?
Darwin was not just intrigued by the living organisms he found but also collected ____________________ (preserved remains of ancient organisms).
Some fossils resembled creatures that were still alive; others were unlike anything he’d ever seen.
The Galapagos islands, off the coast of _______________________________ where of special interest to Darwin. Though the islands were close together the climate varied dramatically as one traveled north and south.
The northern islands had regular rainfall and were ________________________.
The southern islands were hot and dry and _______________________________.
Darwin noted many interesting animals while in the Galapagos such as the ____________________ whose shells seemed to be unique to the islands on which they were found, and the __________________ with its many differently shaped beaks.
Darwin observed that the ________________________ of many ______________ & _______________
___________________________________________
among the different islands of the Galapagos.
*******************************************************************************
March 10 - 14
SPRING BREAK
******************************************************************************
March 17 - 21
M Class Notes on Speciation ** see below **
T Class activity- Allel frequency lab
HW: Crossword puzzle chap. 15 & 16 due 3/19
W Open Note quiz
New vocabulary: classification & taxonomy due 3/20
Th Class notes & class activity on Classification & Taxonomy ** see below**
HW: Review for Population Genetics & Evolution exam due 3/25
** Population Genetics & Evolution exam Thursday 3/27**
F Holiday
**Speciation
Polygenic traits tend to have a bell-curve shaped distribution pattern.
Draw a bell curve. (Hint: remember the poster we made of height as a class; what basic shape did it have?)
Natural Selection is the mechanism of evolution in which the individuals with the highest fitness for their environment are able to survive and reproduce.
Natural Selection affects the distribution of phenotypes in any of 3 ways:
Directional Selection: when individuals at one end of the curve have higher fitness than individuals in the middle or at the other end of the curve.
In a forest of many different types of trees with dark, med & light brown bark scientist recorded that an even distribution of brown color existed in the forest’s moth population Moths hid from predators by blending in with the bark and using it for camouflage.
Five years ago a logging company started cutting down all the dark wood trees and some of the medium brown trees to sell.
o Now what color are the individuals with the highest fitness?_______________________
o Now what color are the individuals with the lowest fitness?________________________
o How does the distribution change?
Stabilizing selection: individuals near the center of the curve have a higher fitness than individuals at either end of the curve.
Over the years scientists have noticed a correlation between birth weight and infant mortality. Not only do very small babies have high mortality rates but so do very large babies.
o What weight are the babies with the highest fitness? _______________
o What weight are the babies with the lowest fitness? ________________
o How does the distribution change?
Disruptive Selection: individuals at the upper & lower ends of the curve have hither fitness than individuals near the middle.
One reason that the finches on the Galapagos might have evolved to have different beak sizes is that if small and large seeds were most common in an area the bird population would split into two subgroups specializing in eating different sized seeds: little beaks for little seeds, large beaks for large seeds.
o What size beaks do those with the highest fitness have?____________________
o What size beaks do those with the lowest fitness have? _____________________
o How does the distribution change?
Genetic drift: in small populations, individuals that carry a particular allele may leave more descendants than others just by chance. Over time a series of chance occurrences can cause an allele to become more or less common in a population.
To better understand evolutionary change it is helpful to know…
What happens when there is no change?
Genetic equilibrium , where allele frequency in a population will remain constant, is maintained when 5 factors are met:
random mating
large population
no migration into or out of the population
no mutations
no natural selection
Species: a group of closely related individuals that mate and produce viable offspring Speciation: the formation of new species.
When the members of 2 populations cannot interbreed and produces viable offspring, reproductive isolation has occurred.
Behavioral Isolation: occurs when 2 populations are capable of interbreeding but have differences in behavior such as courtship rituals or other reproductive strategies.
Geographic Isolation: two populations are separated by geographic barriers such as rivers, mountains or bodies of water.
Temporal Isolation: two or more species reproduce at different times.
**Notes: Classification and Taxonomy
Life has been evolving on Earth for more than ______________________ years and scientists have identified more than ____________________ species and scientists estimate that between 2 and 100 million more species have yet to be discovered.
Why Classify?
Biologists use a _________________________________ to _______________________
and ________________________________________________ in a logical manner to study the _______________________________________________________.
We all use classification systems every day and most of them work in the same way by moving from ________________________ specific to ___________________ specific.
i.e. Teacher High School Teacher High School Biology Teacher
So, for all time people have been trying to classify the life that exists around them.
To avoid the confusion caused by regional names,
biologists use a classification system to
_____________________________________________________
and to _____________________________________________________
Taxonomy- the discipline of _________________________________ to a universally accepted name.
Binomial Nomenclature is a two-word naming system developed by a Swedish botanist, ____________________________________, where each species is assigned a ___________________________ _______________________________.
Scientific Name What is the scientific name
• always written in italics for humans?
• first word (genus) is capitalized
• second word (species) lower case ____________ ___________
Linnaeus’s hierarchical system of classification includes seen levels.
Largest Smallest
Kingdom Phylum Order Family Genus Species
Mnemonic device: King Phillip came over for grape soda.
Your turn:
Kingdom: Animalia
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: sapiens
March 24- 28
M Class notes on Kingdoms, Domains & Dichotomous Keys ** Review due tomorrow**
T Class notes on Classification and Cladograms
HW: Shark Dichotomous Key
W Jeopardy Review for Evolution Exam, Pass back and go over review
Th Population Genetics & Evolution Exam over Chapters 15 & 16 as well as from Biotech to Speciation
F **New Divider** Viruses, Bacteria and Immunity
class notes
HW: Color coding the lytic and lysogenic cycle
March 31- April 4
M Continued Class notes on Viruses and Immunity
HW Viruses & Immunity Crossword Puzzle
T In class lab OUTBREAK: viral transmission
HW Chapter 40 Review
W Video: Understanding viruses
Th Chapter 40 comprehension problems 1-10 pg. 1057
F Chapter 19 comprehension problems 1-10 pg. 493
** Viruses, Immunity & Bacteria Exam Friday 4/11**
******************************************************************************
April 7- 11
M Class notes: Bacteria
Review sheet for test: viruses, immunity & bacteria Due 4/10
T Continue lass notes: Bacteria
HW: Bacteria Coloring Guide
** six week exam next tuesday 4/15 to review go over reviews for
population genetics and virus, immunity & bacteria**
W Read: Bacteria in the gut
Lab: Bacteria collection
Th Late Start
Veiw plates from bacteria collection
go over review
F Test: viruses, Immunity and Bacteria
April 14- 18
M In-class reveiw for six week exam
T Six week exam over population genetics, evolution, classification, viruses, immunity & bacteria
W Protists & Fungi Differentiated Learning
Th Protists and Fungi Differentiated Learning
F Video 'Understanding Viruses'
******************************************************************************
April 21 - 25
M Notes Protists & Fungi *see below
Native Texas Animal Project due May 8 (E.C. is turned in by May 6)
T Class reading 'Athlete's Foot'
W Open note quiz over Protist and Fungi note(chapter 20 & 21)
HW Chapter 22 vocab worksheet *see below
Th Notes: Monocots & Dicots
HW Chapter 22 Review Qustions 1-10 (in the book)- write out question & answer
F Monocot & Dicot inclass activity
*Kingdom Fungi (Chapter 21)
Characteristics
* multicellular
* Eukaryotic ( cells has nucleus and membrane-bound organelles)
* Reproduce sexually and asexually
* spore production ( asexual ) - reproductive cell that grows into a new
individual. Spores are very light and float in the air.
* Heterotroph - no chlorophyll (DO NOT photosynthesize)
Digest externally, then absorb the food
Importance
* Beneficial - food (mushrooms), decomposers, yeast, penicillin
* Harmful - Athlete's foot, ringworm, Jock itch, Dutch Elm disease, Oak wilt
* Composed of hyphae ( threadlike structures)
* Hyphae branch to form a network called a Mycellium
* cells walls contain chitin ( found in exoskeletons of insects "crunch")
Notes: Protista ( Chapter 20)
Kingdom Protista
* Eukaryotic (true nucleus)
* unicellular
* some are plantlike, others are animal-like
( 1 cell + nucleus = Kingdom Protista)
Animal-like Protists
* classified by movement
1. Sarcodines (pseudopod = false foot)
* move by extending cytoplasm
* feed by extending pseudopod around food and trapping it in a food vacuole
Ex. Amoeba
2. Ciliates
*move by use of cilia ( hairlike structures)
*feed through oral groove
Ex. Paramecium
3. Flagellates
*move by use of flagella (whip-like tail)
Ex. Trypanosoma causes African sleeping sickness
Euglena is both plant-like and animal-like
4. Sporozoans
*no means of locomotion; must rely on air, water, other organisms to
transport
*all sporozoans are parasites
Ex. Plasmodium vivax causes malaria
Plant-like Protists
*commonly called algae
*algae provides most of our oxygen and serves as food for marine life
* algae is classified according to the type of photosynthetic pigment it contains:
brown, red, yellow or green
Ex. diatoms (golden algae)
dinoflagellates (bioluminescent)
volvox (colonial)
Project : Native Texas Animal Due _____________________
Common Name _______________ Scientific Name _________________
You will be given the opportunity to investigate animals that live in our state. Your job is to design an informative, interesting, visual display.
Basic Requirements:
I. Poster display & presentation including neatly written / typewritten
information including the following:
*Common/Scientific names written correctly
*Habitat
*3 interesting facts
II. Drawing of animal using realistic colors (you may trace this but it
must be large enough to see from the back of the room) You MAY
NOT simply print out a picture.
III. Drawing of food web (not just a food chain)
IV. Maps of Texas and Worldwide distribution (outlines attached)
V. Proper bibliography – cite the sources where you gained information
(Minimum of 3 different sources).
The following are examples of properly written bibliographies:
from a book:
Dawson, Everett T. Texas Wildlife, Dallas, Tx.: Banks Upshaw and Company,
1955
from a signed article in a magazine:
Whittemore, Reed. “The Newspeak Generation.” Newsweek, February 1992,
pp. 17-21.
from an unsigned article in a magazine:
“How to Save Endangered Species.” National Geographic, January 1992,
pp. 70-80.
from a newspaper article:
Cowan, Edward, :Controlled Breeding of Animals.” Austin American
Statesman, 7 April 1991, sec E. p. 4.
from an encyclopedia article:
McGuire, William J. “Animals.” Encyclopedia Britannica. 1991 ed.
from a website:
http://www.tpwd.state.tx.us/huntwild/wild/species/
*Chapter 22: Plant Vocabulary
What is a plant? (pg. 551)
Reproduce figure 22-6 including pictures and highlighted/ important changes.
April 28- May 2
M Computer Lab- Research Day for Native Texas Animals Project
T TAKS- No class
W TAKS- In class movie, say good-bye to the apprentice teacher
Th TAKS- No class
F TAKS- In class movie (6th), Bowie Birthday Party(8th)
*******************************************************************************
May 5 - 9
*** DON'T FORGET PROJECT ARE DUE MAY 8 ( MAY 6 IF YOU WANT EXTRA CREDIT)
M 3-D Flower
H.W. p. 629 Chapter 24 assessment # 1-10 due 5/6
T Kingdom Animalia Safari
W Animal Classification practice
H.W. p. 845 Chapter 32 assessment # 1-10 due 5/8
OPEN NOTE QUIZ TOMORROW OVER PLANTS & ANIMALS
*****PROJECTS/PRESENTATIONS DUE TOMORROW
Th Project Presentations
F Project Presentations
******************************************************************************
May 12 - 16
M Any last projects ???
Begin reviewing for Final Exams
(Review sheets can be found below)
T - F Group Teach
In class review activity
Due May 21
Bielke - Review Sheet - Biology IB - Spring 2008
DNA AND RNA & Protein Synthesis
1. The sugar in DNA is called _________ and the sugar in RNA is called________.
2. The sides of the DNA ladder consist of alternating _________ and ________.
3. In DNA guanine pairs with _______ while adenine pairs with ________.
4. DNA is made up of smaller units called ___________.
5. ________ is the copying of the DNA molecule.
6. The process through which part of the DNA molecule is copied to make proteins is called _________ __________.
7. The ________ of nitrogen bases in DNA acts as a chemical code.
8. Replication of DNA begins when the strands separate at in the _______ of the _______ bases.
9. The result of replication is two _________ molecules of DNA.
10. The four nitrogen bases of DNA are _________, _________, _________, and _________. They are the same for RNA except _________, which replaces ________.
11. RNA exists in ____ different forms. ____RNA which copies the code from DNA and carries it out of the nucleus. ____ RNA which seeks out and delivers proper amino acids to the ribosomes, and ____ RNA which helps bond the amino acids together.
12. _______ _________are the building blocks of proteins.
13. An enzyme is a ________ which changes the _______ of chemical reactions without being used up in the reaction.
14. If the DNA codon is TACGCA, the corresponding mRNA is ______.
GENETICS
15. A _____ is a segment of DNA that helps control a hereditary trait.
16. _________ are made up of genes. _________ are specific characteristics within the gene.
17. An organism's outward appearance is its ___________.
18. An organism's genetic makeup is know as it's ____________.
19. When both alleles on a chromosome have the same expression, the organism is ____________ for that trait.
20. Bb is ___________ while BB or bb is ___________.
21. In ___________ dominance, traits appear to blend.
22. A ___________ is an organism that does not show symptoms of a disorder, but has the recessive allele that may be inherited by its offspring.
23. What is a mutation ?
24. What is a mutagen ?
What are some possible mutagens ?
In fruit flies, a dark body (D) is dominant and light body (d ) is recessive. One parent is homozygous recessive and the other is heterozygous.
25. What is the genotype of the homozygous recessive parent ?
26. What is the genotype of the heterozygous parent?
27. What percentage offspring from the cross are dark body colored ?
28. What percentage offspring from the cross are light body colored ?
A normally pigmented squirrel is heterozygous dominant (N), while his mate is recessive for albinism.
29. What offspring would this cross yield ?
30. What is the genotype for a female organism ? male organism?
31. Does the male or female determine the sex of a child ?
32. What is a sex-linked trait ?
33. Which chromosome are sex-linked traits found on ?
34. Why are males more likely to express a sex-linked trait than females ?
35. What is meant by the term "carrier"?
36. What is a karyotype ?
Mom is a carrier of hemophilia. Dad is a hemophiliac.
37. What is the chance (%) of them having a normal child ?
What is the chance (%) of them having a carrier child ?
38. What is a pedigree and how is it used in genetics?
39. Draw and label a pedigree chart in which the P generation (grandparents)have Brown eyes (which are dominant) and one female grandchild has blue eyes in the space below.
Answer the following:
a. What does a half shaded circle indicate ?
b. Does this person have the trait ?
c. How do sex-linked traits differ from autosomal traits?
40. What are four possible human blood types ?
41. Give the possible genotypes for each blood type.
42. Use a Punnett square to predict the offspring of a cross between an AB an O
POPULATIONS AND EVOLUTION
43. A group of closely related organisms that can mate and product fertile offspring are known as a ___________.
44. All of the individuals in a species in a certain area make up a __________.
45. The amount of organisms that a population can support over an indefinite period of time is known as the _________ __________.
46. What is a "vestigial organ"?
Give an example -
47. The sum of all the genes in a population is known as the ______ ______.
48. Why don't populations grow indefinitely ?
49. The percentage of a particular allele found in a population is known as the _________ __________.
50. Organisms with "favorable traits" tend to survive, reproduce and pass these traits on to their offspring. This is known as ___________ __________.
51. Some moths have developed markings on their wings that resemble the eyes of an owl. This helps to ward off predators. This adaptation is known as _________.
52. List some factors that can contribute to genetic variation or change in allelic frequency in a population:
53. Vestigial organs and homologous structures help to lend evidence to the theory of evolution. Give examples of each.
54. What is genetic equilibrium ?
55. Species with a multiple set of chromosomes are known as ________.
56. The idea that species form by gradual change over time is known as _______.
57. ___________ evolution occurs when distantly related life forms develop similar traits.
58. What mechanism is responsible for the selection of favorable traits in a species?
59. When two or more species become more separated over time ___________ evolution occurs.
60. When a physical barrier divides a population it is known as ___________ isolation.
61. Breeders of pedigreed animals probably use _________ __________ in order to insure that only desired traits appear in the offspring.
MITOSIS (CANCER) & MEIOSIS
62. Explain the difference between the following pairs of words: BE DETAILED
a. mitosis and meiosis
b. haploid and diploid
c. egg and sperm
63. How many chromosomes do humans have ?
64. Why do cells remain small in size ?
65. Define the following:
a. metastasis
b. oncogene
c. carcinogen
66. List three treatments for cancer:
67. What is the difference between sexual and asexual reproduction?
68. Define gamete:
69. Which type of cell division occurs in somatic cells ?
Which type of cell division occurs in gametes ?
70. What is a zygote ?
71. Draw and label (describe) the stages of Mitosis and Meiosis
VIRUSES / BACTERIA/ IMMUNITY
72 Draw and label the Lytic cycle:
73. How does the Lytic cycle differ from the Lysogenic cycle ?
74. What is your body's first line of defense?
75. Discuss your body's immune response should an invader get past the first line of defense. Be sure to describe all of the different types of cells and their jobs.
76. Are viruses alive?
Why do some people think they are ?
77. What type of virus is H.I.V ?
What do most A.I.D.S. patients die from ?
78. List the contributions to science of each of the following:
Edward Jenner
Jonas Salk
Louis Pasteur
Dmitri Iwanoski
Thomas Huxley
79. What is difference between a prokaryotic and eukaryotic cell ?
80. List and draw the three shapes of bacteria:
81. Define the following:
obligate aerobe-
obligate anaerobe-
facultative anaerobe-
82. Define the following:
binary fission-
conjugation-
saprophyte-
symbiosis-
parasite-
83. List some helpful bacteria-
List some harmful bacteria-
TAXONOMY / CLASSIFICATION
84. List the 6 Kingdoms and draw and give an example of each.
85. What are the seven levels of classification from broadest to most specific?
86. Explain how to use a dichotomous key .
87. Develop a short dichotomous key that could identify YOU.
KINGDOM PROTISTA & KINGDOM FUNGI
88. Protists are ________karyotes and ________cellular.
89 Protists are classified according to their ___________.
90 Illustrate how Protists eat and drink. Include the correct terminology meaning "eating" and "drinking" .
91 Define the following:
cilia –
flagella –
pseudopod –
92 What is the purpose of an anal pore ?
93 What are the four different types of Protists?
94 Give some examples of Flagellates.
95 What are Plant-like Protists. Give some examples.
96 How do Fungi reproduce?
97 Fungi are (autotrophic / heterotrophic ). What does that mean ?
98 Define the following"
hyphae –
mycellium –
PLANTS /FLOWERS
99. Plants with only one cotyledon or seedleaf are known as _________ while plants with two cotyledons are known as _________.
100 .___________ is the name given to that group of plants that produce flowers and develop seeds in a fruit.
101. _________ are the reproductive organs of a plant.
102 .Draw and label a complete flower.
103.List differences between monocots and dicots.
HUMAN SYSTEMS
105. All organisms are made of ________.
106.The levels of organization in the humans body start with cells, followed by ___________, which form ____________, which form _________ _________.
107. (Chapters 35 - 40 Dragonfly)
List the major organ systems in your body and briefly describe each one.
a.
b.
c.
d.
e.
f.
g.
h.
i.
j.
k.
108. What was the most interesting thing you learned throughout this year?
109. What did you find the most difficult to understand ?
*******************************************************************************
May 19 - 23
M TEXTBOOKS DUE
Group review
T Finalize for Group Teach
W - F Group Teach
*******************************************************************************
May 26 - 30
M Holiday
T Any last Group Teach ???
W - Th Teach/ Review
F Final Exams 1st and 6th period
********************************************************************************
June 2 - 4
M Final Exams 2nd and 3rd
T Final Exams 7th & 8th
W Final Exams 4th & 5th
Grades will be posted outside of my door by 4:00 pm each day.
*******************************************************************************
HAVE A GREAT SUMMER VACATION !!!
Education Gateways makes no warranty for SchoolNotes.com.
Information on this site is generated by the users. The views
expressed are not necessarily those of Education Gateways or its members, and
Education Gateways is not responsible for user's conduct on SchoolNotes.com.